Clever Geek Handbook
📜 ⬆️ ⬇️

Toxin-antitoxin system

(A) Vertical gene transfer of the toxin-antitoxin system. (B) Horizontal toxin-antitoxin system gene transfer. PSK is a post-segregation killing, and TA are loci encoding toxin and antitoxin [1] .

The toxin-antitoxin system ( toxin-antitoxin system ) is a set of two or more closely related genes that together encode a protein — the “poison” and the corresponding “antidote”. When such a system is localized on a plasmid (an autonomous genetic element), the daughter cell will survive only if it inherits the plasmid as a result of the division of the original cell containing the plasmid. If the daughter cell lacks a plasmid, then unstable antitoxin inherited from the mother's cytoplasm is destroyed, and a stable toxic protein kills the cell; This phenomenon is called “ post-segregation killing ” ( English post-segregational killing, PSK ) [2] [3] . Toxin-antitoxin systems are widely distributed among prokaryotes , and often one prokaryotic organism contains many copies of such systems [4] [5] .

Toxin-antitoxin systems are usually classified according to how antitoxin neutralizes a toxin . In the case of Toxin-Antitoxin Type I systems, the translation of the mRNA encoding the toxin is suppressed upon binding with it a small non-coding RNA serving as an antitoxin. In the case of type II systems, the protein-toxin is inhibited post-translationally by binding to another protein, the antitoxin. One example of type III systems is known in which the protein-toxin directly binds to RNA antitoxin [6] . The genes encoding the toxin-antitoxin are often transferred from the body to the body through horizontal gene transfer [7] . Often they are associated with pathogenic bacteria and are often localized on plasmids carrying the genes for virulence and resistance to antibiotics [1] .

There are also chromosomal systems toxin-antitoxin, some of which are involved in such cellular processes as the response to stress, cell cycle arrest and programmed cell death [1] [8] . From the point of view of the evolution of the system, toxin-antitoxin can be considered as , that is, the purpose of these systems is to increase their own population regardless of whether they bring benefit or harm to the host organism. Adaptive theories have been proposed to explain the evolution of toxin-antitoxin systems; for example, it is possible that the chromosomal systems toxin-antitoxin appeared in order to prevent the inheritance of large deletions in the host genome [9] . Toxin-antitoxin systems have found application in biotechnology , for example, in the method of maintaining plasmids in cell lines . They can serve as antibiotic targets and be used as vectors for positive selection [10] .

Content

Evolutionary benefits

Plasmids containing toxin-antitoxin systems are considered as an example of a selfish DNA within the framework of the ( eng. Gene-centered view of evolution ). It is believed that toxin-antitoxin systems can only maintain their own DNA, even to the detriment of the host organism [1] . According to other theories, these systems increase the fitness of the plasmids carrying them compared to ordinary plasmids [11] . In this case, the toxin-antitoxin systems help the host DNA, eliminating the progeny of the cell from other plasmids (the toxin-antitoxin system localized on the plasmid leads to the death of cells not inherited from the division of this plasmid, therefore, if the cell dies, then plasmids are eliminated). This view is supported by computer modeling data [12] . However, it does not explain the presence of toxin-antitoxin systems on chromosomes .

 
A map of the chromosome, showing the 25 toxin-antitoxin systems located on it. Orange color indicates the system, the existence of which is precisely established [13] , and green color indicates the proposed system [14]

There are a number of adaptive theories explaining the evolutionary advantage of chromosomal systems of toxin-antitoxin over natural selection . The simplest explanation for the existence of such systems on chromosomes is that they prevent the occurrence of dangerous large deletions in the cell genome [9] . Toxin-antitoxin locus MazEF Escherichia coli and other bacteria induces programmed cell death in response to prolonged starvation , especially in the absence of amino acids [15] . The contents of the dead cells are absorbed by neighboring cells, that is, possibly, prevents the death of the close relatives of the dead cells and thereby increases the dead cells. Such an example of altruism brings bacterial colonies closer to multicellular organisms [12] .

According to another theory, the toxin-antitoxin chromosomal systems are , but not bactericidal [16] . For example, RelE globally inhibits translation in the face of nutrient deficiencies , and its expression reduces the risk of starvation by reducing the cell's nutrient requirements [17] . The mazF toxin homolog , mazF-mx, is necessary for the formation of fruit bodies in Myxococcus xanthus [18] . These bacteria form dense clusters, and with a nutrient deficiency, a group of 50,000 cells form a fruit body [19] . The maxF-mx toxin is a component of the stress response pathway caused by nutrient deficiencies, and allows some cells of the fruit body to form myxospores. It was suggested that M. xanthus “enslaved” the toxin-antitoxin system and took the antitoxin under its own molecular control to regulate its life cycle [18] .

It has been suggested that chromosomal copies of the toxin-antitoxin systems can provide , that is, help to exclude the plasmid from the progeny of the cell without exposing it to the toxin. For example, in the genome, an antitoxin is encoded, which counteracts the toxin encoded by the F plasmid [20] .

Nine possible functions of toxin-antitoxin systems have been proposed [21] :

  1. Cellular "trash": toxin-antitoxin systems were borrowed from plasmids and left in cells due to the development of habituation to their toxins.
  2. Stabilization of genomic parasites (residues from transposons and bacteriophages ). The presence of toxin-antitoxin systems on these elements can bring them benefits, reducing the possibility of their deletions. On closer inspection, many chromosomal toxin-antitoxin systems may actually belong to the parasitic elements embedded in the genome or their residues.
  3. Selfish alleles : during recombination , non-addictive alleles cannot replace addictive alleles, but the opposite substitution is possible.
  4. Gene regulation: some toxins act as general repressors of gene expression [22] , while others are more specific [23] .
  5. Growth control: as noted, bacteriostatic toxins do not kill the host cell, but limit its growth [16] .
  6. Resistant cells : in some populations of bacteria, there is a subpopulation of cells that is resistant to a variety of antibiotics , controlled by toxin-antitoxin systems. These slow-growing, hardy cells insure a population of extinction [24] .
  7. Programmed cell death and the survival of its close relatives, as in the example of altruism described by MazEF described above (see above).
  8. Different levels of resistance of the cells of the population to stressful conditions, causing programmed death of some cells, which prevents the extinction of the entire population.
  9. Bacteriophage counteraction: when a bacteriophage interferes with transcription and translation of cellular proteins, activation of toxin-antitoxin systems limits phage replication [25] [26] .

However, an experiment in which five toxin-antitoxin systems were removed from E. coli cells did not give any evidence of the existence of the advantages that the toxin-antitoxin systems give to the host cell. These results cast doubts on the hypotheses of growth control and programmed cell death [27] .

Classification

Type I

 
System hok / sok (type I toxin-antitoxin systems)

The action of the toxin-antitoxin type I systems is due to the complementary pairing of the bases of the RNA-antitoxin with the mRNA encoding the protein-toxin. The translation of this mRNA is suppressed either due to the destruction by RNase III , or due to a decrease in the availability of the Shine-Dalgarno sequence or . In these cases, the toxin and antitoxin are often encoded by opposite strands of DNA. The overlapping region of these two genes (usually 19-23 nucleotides in length ) determines their complementary pairing [28] .

Toxins in type I systems are represented by small hydrophobic proteins, the toxicity of which is due to their ability to destroy cell membranes [1] . Only a few toxins of type I systems have identified intracellular targets, possibly due to the difficulties associated with the study of proteins that are toxic to the cells containing them [8] .

Sometimes type I systems include a third component. In the case of a well-studied hok / sok system, in addition to the hok toxin and the antitoxin sok, there is a third gene called mok . It almost completely overlaps with the gene that encodes the toxin, and the translation of the toxin depends on the translation of this third component [3] . For this reason, the idea of ​​the binding of a toxin to an antitoxin is in some cases a simplification, and the antitoxin actually binds to a third RNA, which already then acts to translate the toxin [28] .

System Examples

ToxinAntitoxinCommentA source
HokSokThe first known and most well-studied type I system that stabilizes plasmids in a number of gram-negative bacteria[28]
RNAIIThe first type I system identified in a gram-positive bacterium is found in enterococcus.[29]
IstrResponds to DNA damage[thirty]
RdldChromosomal system, found in enterobacteria[31]
FlmBHomolog hok / sok, which also stabilizes the F-plasmid[32]
IbsOriginally named QUAD-RNA. Opened in the E. coli[33]
RataProvides skin element inheritance during sporulation in Bacillus subtilis[34]
SymRChromosomal system induced by SOS response[five]
XCV2162Identified in and occurs in phylogenetically diverse organisms.[35]

Type II

 
Arrangement of genes in a typical locus of the toxin-antitoxin type II system [14]

Type II systems are better studied than type I systems [28] . In these systems, the unstable protein-antitoxin strongly binds to a stable toxin and inhibits its activity [8] . The largest family of systems of this type is [36] , and using bioinformatics methods , it was found that from 37 to 42% of type II systems belong to this family [13] [14] .

Type II systems are usually organized into operons , and the gene encoding the antitoxin is usually located higher than the gene encoding the toxin. Antitoxin suppresses the toxin, negatively regulating its expression. Toxin and antitoxin, as a rule, have a length of about 100 amino acid residues [28] . The toxicity of the toxin may be due to several properties. The CcdB protein, for example, disrupts DNA topoisomerase and DNA gyrase [37] , and the MazF protein is a dangerous endoribonuclease that cuts cellular mRNA for specific motives [38] . The most common toxins are endonucleases, which are also known as interferases [39] [40] .

Sometimes in systems of toxin-antitoxin type II, a third protein appears [41] . In the case of the aforementioned MazEF system, there is an additional regulatory protein, MazG. It interacts with E. coli ETP GTPase and is characterized as nucleoside triphosphate pyrophosphate hydrolase [42] , which hydrolyzes nucleoside triphosphates to monophosphates. Further studies have shown that MazG is transcribed into the same polycistronic RNA as MazE and MazF, and MazG binds to the MazF toxin, further inhibiting its activity [43] .

System Examples

ToxinAntitoxinCommentA source
CcdALocated in the F plasmid E. coli[37]
ParDAvailable in multiple copies from [44]
MazfMazeIt is found on the chromosome of E. coli and other bacteria.[25]
yafOyafNThe system is induced by the SOS response to DNA damage in E. coli[41]
HicaHicbFound in archaea and bacteria[45]
KidKisStabilizes plasmid ; related to the CcdB / A system[sixteen]

Type III

Toxin ToxN
Identifiers
SymbolToxN, type III toxin-antitoxin systems
PfamPF13958
Available protein structures
Pfamstructures
PDBRCSB PDB ; PDBe ; PDBj
PDBsum3D model

Type III toxin-antitoxin systems rely on direct interaction of the protein-toxin and RNA-antitoxin. The toxic effects of protein are directly neutralized by RNA [6] . The only currently known example is the ToxIN system, found in plant pathogenic bacteria . The ToxN protein toxin has a length of about 170 amino acid residues and is toxic to E. coli . Its toxicity is suppressed by ToxI RNA , which contains 5.5 tandem repeats of the 36 nucleotide motif (AGGTGATTTGCTACCTTTAAGTGCAGCTAGAAATTC) [46] [47] . Crystallographic analysis of ToxIN showed that to inhibit ToxN, the formation of a ToxIN trimeric complex is necessary, in which three monomers are linked to three ToxN monomers. The complex is retained due to multiple RNA-protein interactions [48] .

Biotech Applications

Biotechnological use of toxin-antitoxin systems was initiated by several biotechnology companies [10] [16] . Toxin-antitoxin systems are mainly used to maintain plasmids in large bacterial cell cultures. An experiment testing the effectiveness of the hok / sok locus showed that the inserted plasmid expressing beta-galactosidase retained 8–22 times more stability in cell division than in the control culture lacking the toxin-antitoxin system [49] [50] . In widely used microbiological processes, such as fermentation , those daughter cells that did not inherit the plasmid are more adaptable than the cells containing the plasmids, and in the end, cells lacking the plasmid can completely displace valuable industrial microorganisms. Thus, toxin-antitoxin systems that help maintain important plasmids help maintain the efficiency of industrial processes [10] .

In addition, toxin-antitoxin systems may in future be targeted by antibiotics. The induction of molecules that are harmful to pathogens can help overcome the growing problem of multidrug resistance [51] .

The selection of plasmids containing the is a widespread problem when DNA is cloned . Toxin-antitoxin systems can be used to positively select only those cells that contain the plasmid with the insert of interest to the researcher, discarding those cells that do not contain the inserted gene. For example, the CcdB gene encoding the toxin is inserted into plasmid vectors [52] . The gene of interest then recombines with the CcdB gene, inactivating the transcription of the toxic protein. Therefore, transformed cells containing a plasmid, but not the insert, die because of the toxic properties of the CcdB protein , and only those cells that have a plasmid with the insert survive [10] .

It is also possible to use both CcdB toxin and CcdA antitoxin. CcdB is in the recombinant genome of the bacterium, and the inactivated version of CcdA is inserted into the linear plasmid vector. A short sequence is stitched to the gene of interest, which activates the antitoxin gene when it is inserted into this place. Using this method, a directionally specific gene insertion can be obtained [52] .

Notes

  1. 2 1 2 3 4 5 Van Melderen L. , Saavedra De Bast M. Bacterial toxin-antitoxin systems: more than selfish entities? (English) // PLoS genetics. - 2009. - Vol. 5, no. 3 - P. e1000437. - DOI : 10.1371 / journal.pgen.1000437 . - PMID 19325885 .
  2. ↑ Gerdes K. Toxin-antitoxin modules may regulate synthesis of macromolecules during nutritional stress. (English) // Journal of bacteriology. - 2000. - Vol. 182, no. 3 P. 561-572. - PMID 10633087 .
  3. 2 1 2 Faridani OR , Nikravesh A. , Pandey DP , Gerdes K. , Good L. Sok-RNA interactions activates Hok-mediated cell killing in Escherichia coli. (Eng.) // Nucleic acids research. - 2006. - Vol. 34, no. 20 - P. 5915-5922. - DOI : 10.1093 / nar / gkl750 . - PMID 17065468 .
  4. Zo Fozo EM , Makarova KS , Shabalina SA , Yutin N. , Koonin EV , Storz G. Abundance of type I and xxin-antitoxin systems. (Eng.) // Nucleic acids research. - 2010. - Vol. 38, no. 11 - P. 3743-3759. - DOI : 10.1093 / nar / gkq054 . - PMID 20156992 .
  5. ↑ 1 2 Gerdes K. , Wagner EG RNA antitoxins. (English) // Current opinion in microbiology. - 2007. - Vol. 10, no. 2 - P. 117-144. - DOI : 10.1016 / j.mib.2007.03.03.003 . - PMID 17376733 .
  6. ↑ 1 2 Labrie SJ , Samson JE , Moineau S. Bacteriophage resistance mechanisms. (Eng.) // Nature reviews. Microbiology. - 2010. - Vol. 8, no. 5 - p. 317–327. - DOI : 10.1038 / nrmicro2315 . - PMID 20348932 .
  7. ↑ Mine N. , Guglielmini J. , Wilbaux M. , Van Melderen L. The decay of the chromosomally encoded ccdO157 toxin-antitoxin system in the Escherichia coli species. (English) // Genetics. - 2009. - Vol. 181, no. 4 - P. 1557-1566. - DOI : 10.1534 / genetics.108.095190 . - PMID 19189956 .
  8. 2 1 2 3 Hayes F. Toxins-antitoxins: plasmid maintenance, programmed cell death, and cell cycle arrest. (eng.) // Science (New York, NY). - 2003. - Vol. 301, no. 5639 . P. 1496-1499. - DOI : 10.1126 / science.1088157 . - PMID 12970556 .
  9. 2 1 2 Rowe-Magnus DA , Guerout AM , Biskri L. , Bouige P. , Mazel D. Comparative analysis of superintegrons: engineering extensive diversity in the Vibrionaceae. (English) // Genome research. - 2003. - Vol. 13, no. 3 - P. 428—442. - DOI : 10.1101 / gr.617103 . - PMID 12618374 .
  10. 2 1 2 3 4 Stieber D. , Gabant P. , Szpirer C. The art of selective killing: plasmid toxin / antitoxin systems and their technological applications. (English) // BioTechniques. - 2008. - Vol. 45, no. 3 - P. 344-346. - DOI : 10.2144 / 000112955 . - PMID 18778262 .
  11. Ine Cooper TF , Heinemann JA Postsegregational killing doesn’t matter of competing plasmids. (Eng.) // Proceedings of the National Academy of Sciences of the United States of America. - 2000. - Vol. 97, no. 23 . - P. 12643-12464. - DOI : 10.1073 / pnas.220077897 . - PMID 11058151 .
  12. 2 1 2 Mochizuki A. , Yahara K. , Kobayashi I. , Iwasa Y. Genetic addiction: selfish strategy for symbiosis in the genome. (English) // Genetics. - 2006. - Vol. 172, no. 2 - P. 1309-1323. - DOI : 10.1534 / genetics.105.042895 . - PMID 16299387 .
  13. 2 1 2 Pandey DP , Gerdes K. Toxin-antitoxin locally are lost from host-associated prokaryotes. (Eng.) // Nucleic acids research. - 2005. - Vol. 33, no. 3 - P. 966-976. - DOI : 10.1093 / nar / gki201 . - PMID 15718296 .
  14. 2 1 2 3 Sevin EW , Barloy-Hubler F. RASTA-Bacteria: a web-based tool for identifying toxin-antitoxin loci in prokaryotes. (English) // Genome biology. - 2007. - Vol. 8, no. 8 - P. 155. - DOI : 10.1186 / gb-2007-8-8-r155 . - PMID 17678530 .
  15. ↑ Aizenman E. , Engelberg-Kulka, H. , Glaser G. Anesthesia coli chromosomal addiction module, corrected 3 ', 5'-bispyrophosphate: a model for programmed bacterial cell death.] (English) // Proceedings of the National Academy of Sciences of the United States of America. - 1996. - Vol. 93, no. 12 - P. 6059-6063. - PMID 8650219 .
  16. ↑ 1 2 3 4 Diago-Navarro E. , Hernandez-Arriaga AM , López-Villarejo J. , Muñoz-Gómez AJ , Kamphuis MB , Boelens R. , Lemonnier M. , Díaz-Orejas R. parD toxin-antitoxin system of plasmid R1 - basic contributions, biotechnological applications and relationships with toxin-antitoxin systems. (eng.) // The FEBS journal. - 2010. - Vol. 277, no. 15 - P. 3097-3117. - DOI : 10.1111 / j.1742-4658.2010.07722.x . - PMID 20569269 .
  17. Ten Christensen SK , Mikkelsen M. , Pedersen K. , Gerdes K. RelE, a global inhibitor of translation, is during nutritional stress. (Eng.) // Proceedings of the National Academy of Sciences of the United States of America. - 2001. - Vol. 98, no. 25 - P. 14328-14333. - DOI : 10.1073 / pnas.251327898 . - PMID 11717402 .
  18. ↑ 1 2 Nariya H. , Inouye M. MazF, an mRNA interferase, mediates programmed cell death during multicellular Myxococcus development. (English) // Cell. - 2008. - Vol. 132, no. 1 . - P. 55-66. - DOI : 10.1016 / j.cell.2007.11.11.044 . - PMID 18191220 .
  19. ↑ Curtis PD , Taylor RG , Welch RD , Shimkets LJ Spatial Organization of Myxococcus xanthus during fruiting body formation. (English) // Journal of bacteriology. - 2007. - Vol. 189, no. 24 - P. 9126-9130. - DOI : 10.1128 / JB.01008-07 . - PMID 17921303 .
  20. ↑ Saavedra De Bast M. , Mine N. , Van Melderen L. Chromosomal toxin-antitoxin systems may act as antiaddiction modules. (English) // Journal of bacteriology. - 2008. - Vol. 190, no. 13 - P. 4603-4609. - DOI : 10.1128 / JB.00357-08 . - PMID 18441063 .
  21. ↑ Magnuson RD Hypothetical functions of toxin-antitoxin systems. (English) // Journal of bacteriology. - 2007. - Vol. 189, no. 17 - P. 6089-6092. - DOI : 10.1128 / JB.00958-07 . - PMID 17616596 .
  22. ↑ Engelberg-Kulka H. , Amitai S. , Kolodkin-Gal I. , Hazan R. Bacterial programmed cell death and multicellular behavior in bacteria. (English) // PLoS genetics. - 2006. - Vol. 2, no. 10 - P. e135. - DOI : 10.1371 / journal.pgen.0020135 . - PMID 17069462 .
  23. ↑ Pimentel B. , Madine MA , de la Cueva-Méndez G. Kid clears specific mRNAs at UUACU sites to rescue the copy number of plasmid R1. (English) // The EMBO journal. - 2005. - Vol. 24, no. 19 - P. 3459-33469. - DOI : 10.1038 / sj.emboj.7600815 . - PMID 16163387 .
  24. ↑ Kussell E. , Kishony R. , Balaban NQ , Leibler S. Bacterial persistence: a model of survival in changing environments. (English) // Genetics. - 2005. - Vol. 169, no. 4 - P. 1807-1814. - DOI : 10.1534 / genetics.104.035352 . - PMID 15687275 .
  25. 2 1 2 Hazan R. , Engelberg-Kulka H. Escherichia coli, P1. (English) // Molecular genetics and genomics: MGG. - 2004. - Vol. 272, no. 2 - P. 227–234. - DOI : 10.1007 / s00438-004-1048-y . - PMID 15316771 .
  26. Co Pecota DC , Wood TK Exclusion of T4 phage by the hok / sok killer locus from plasmid R1. (English) // Journal of bacteriology. - 1996. - Vol. 178, no. 7 - P. 2044-2050. - PMID 8606182 .
  27. Ilib Tsilibaris V. , Maenhaut-Michel G. , Mine N. , Van Melderen L. (English) // Journal of bacteriology. - 2007. - Vol. 189, no. 17 - P. 6101-6108. - DOI : 10.1128 / JB.00527-07 . - PMID 17513477 .
  28. 2 1 2 3 4 5 Fozo EM , Hemm MR , Storz G. Small toxic proteins and antisense RNAs that repress them. (Eng.) // Microbiology and molecular biology reviews: MMBR. - 2008. - Vol. 72, no. 4 - p. 579-589. - DOI : 10.1128 / MMBR.00025-08 . - PMID 19052321 .
  29. Field Greenfield, TJ , Ehli, E. , Kirshenmann, T. , Franch, T. , Gerdes K. , Weaver KE regards the expression of the local pattern. (English) // Molecular microbiology. - 2000. - Vol. 37, no. 3 - P. 652-660. - PMID 10931358 .
  30. ↑ Vogel, J. , Argaman, L. , Wagner, EG , Altuvia , SOS-induced toxic peptide. (eng.) // Current biology: CB. - 2004. - Vol. 14, no. 24 - P. 2271-2276. - DOI : 10.1016 / j.cub.2004.12.003 . - PMID 15620655 .
  31. Aw Kawano M. , Oshima T. , Kasai H. , Mori H. Molecular characterization of the direct direct repeat (LDR) sequences of expressions for a mRNA encoding and a cis-encoded small antisense in Escherichia coli. (English) // Molecular microbiology. - 2002. - Vol. 45, no. 2 - P. 333-349. - PMID 12123448 .
  32. H Loh SM , Cram DS , Skurray RA, Nucleotide sequence and transcriptional analysis of the third function (Flm) involved in F-plasmid maintenance. (English) // Gene. - 1988. - Vol. 66, no. 2 - P. 259-268. - PMID 3049248 .
  33. Zo Fozo EM , Kawano M. , Fontaine F. , Kaya Y. , Mendieta KS , Jones KL , Ocampo A. , Rudd KE , Storz G. Small RNAs. (English) // Molecular microbiology. - 2008. - Vol. 70, no. 5 - P. 1076-1093. - DOI : 10.1111 / j.1365-2958.2008.06394.x . - PMID 18710431 .
  34. ↑ Silvaggi JM , Perkins JB , Losick R. Small untranslated RNA antitoxin in Bacillus subtilis. (English) // Journal of bacteriology. - 2005. - Vol. 187, no. 19 - P. 6641-6650. - DOI : 10.1128 / JB.187.19.6641-6650.2005 . - PMID 16166525 .
  35. ↑ Findeiss S. , Schmidtke C. , Stadler PF , Bonas U. A novel family of plasmid-transferred anti-sense ncRNAs. (eng.) // RNA biology. - 2010. - Vol. 7, no. 2 - P. 120-124. - PMID 20220307 .
  36. ↑ Robson J. , McKenzie JL , Cursons R. , Cook GM , Arcus VL The vapBC operon from Mycobacterium. (English) // Journal of molecular biology. - 2009. - Vol. 390, no. 3 - P. 353-367. - DOI : 10.1016 / j.jmb.2009.05.006 . - PMID 19445953 .
  37. 2 1 2 Bernard P. , Couturier M. Cell killing of the F plasmid CcdB protein includes poisoning of the DNA-topoisomerase II complexes. (English) // Journal of molecular biology. - 1992. - Vol. 226, no. 3 - P. 735-745. - PMID 1324324 .
  38. ↑ Zhang Y. , Zhang J. , Hoeflich KP , Ikura M. , Qing G. , Inouye M. MazF cleaves cellular mRNAs specifically for Escherichia coli. (English) // Molecular cell. - 2003. - Vol. 12, no. 4 - P. 913-923. - PMID 14580342 .
  39. ↑ Christensen-Dalsgaard M. , Overgaard M. , Winther KS , Gerdes K. RNA decay by messenger RNA interferases. (English) // Methods in enzymology. - 2008. - Vol. 447. - p. 521-535. - DOI : 10.1016 / S0076-6879 (08) 02225-8 . - PMID 19161859 .
  40. ↑ Yamaguchi Y. , Inouye M. mRNA interferases, sequence-specific endoribonucleases from the toxin-antitoxin systems. (Eng.) // Progress in molecular biology and translational science. - 2009. - Vol. 85. - p. 467-500. - DOI : 10.1016 / S0079-6603 (08) 00812-X . - PMID 19215780 .
  41. 2 1 2 Singletary LA , Gibson JL , Tanner EJ , McKenzie GJ , Lee PL , Gonzalez C. , Rosenberg SM SOS-regulated type 2 toxin-antitoxin system. (English) // Journal of bacteriology. - 2009. - Vol. 191, no. 24 - P. 7456-7465. - DOI : 10.1128 / JB.00963-09 . - PMID 19837801 .
  42. ↑ Zhang J. , Inouye M. MazG, a nucleoside triphosphate pyrophosphohydrolase, interacting with Era, an essential GTPase in Escherichia coli. (English) // Journal of bacteriology. - 2002. - Vol. 184, no. 19 P. 5323-5329. - PMID 12218018 .
  43. Ross Gross M. , Marianovsky I. , Glaser G. MazG - a regulator of programmed cell death in Escherichia coli. (English) // Molecular microbiology. - 2006. - Vol. 59, no. 2 - P. 590-601. - DOI : 10.1111 / j.1365-2958.2005.04956.x . - PMID 16390452 .
  44. ↑ Fiebig, A. , Castro Rojas, CM , Siegal-Gaskins, D. , Crosson S. Interaction of specificity, Parole / RelE-family toxin-antitoxin systems. (English) // Molecular microbiology. - 2010. - Vol. 77, no. 1 . - P. 236-251. - DOI : 10.1111 / j.1365-2958.2010.07207.x . - PMID 20487277 .
  45. Ø Jørgensen MG , Pandey DP , Jaskolska M. , Gerdes K. Escherichia of the Colonies of the Escherichia colony, mRNA interferases in bacteria and archaea. (English) // Journal of bacteriology. - 2009. - Vol. 191, no. 4 - P. 1191-1199. - DOI : 10.1128 / JB.01013-08 . - PMID 19060138 .
  46. ↑ Fineran PC , Blower TR , Foulds IJ , Humphreys DP , Lilley KS , Salmon GP , ToxIN, functions as a protein-RNA toxin-antitoxin pair. (Eng.) // Proceedings of the National Academy of Sciences of the United States of America. - 2009. - Vol. 106, no. 3 - P. 894-899. - DOI : 10.1073 / pnas.0808832106 . - PMID 19124776 .
  47. Low Blower TR , Fineran PC , Johnson MJ , Toth IK , Humphreys DP , Salmon GP, and Hypergenic locus of Erwinia. (English) // Journal of bacteriology. - 2009. - Vol. 191, no. 19 - P. 6029-6039. - DOI : 10.1128 / JB.00720-09 . - PMID 19633081 .
  48. ↑ Blower TR , Pei XY , Short FL , Fineran PC , Humphreys DP , Luisi BF , Salmon GP A processed noncoding RNA regulates an altruistic bacterial antiviral system. (English) // Nature structural & molecular biology. - 2011. - Vol. 18, no. 2 - P. 185-190. - DOI : 10.1038 / nsmb.1981 . - PMID 21240270 .
  49. U Wu K. , Jahng D. , Wood killer. (English) // Biotechnology progress. - 1994. - Vol. 10, no. 6 - P. 621-629. - DOI : 10.1021 / bp00030a600 . - PMID 7765697 .
  50. Co Pecota DC , Kim CS , Wu K. , Gerdes K. , Wood TK Combine the hok / sok, parDE, and pnd postsegregational killer. (English) // Applied and environmental microbiology. - 1997. - Vol. 63, no. 5 - P. 1917-1924. - PMID 9143123 .
  51. ↑ Gerdes K. , Christensen SK , Løbner-Olesen A. Prokaryotic toxin-antitoxin stress response loci. (Eng.) // Nature reviews. Microbiology. - 2005. - Vol. 3, no. 5 - P. 371-382. - DOI : 10.1038 / nrmicro1147 . - PMID 15864262 .
  52. 2 1 2 Bernard P. , Gabant P. , Bahassi EM , Couturier M. Positive-selection vectors using the F plasmid ccdB killer gene. (English) // Gene. - 1994. - Vol. 148, no. 1 . - P. 71-74. - PMID 7926841 .

Literature

  • Wen J. , Won D. , Fozo EM The ZorO-OrzO type I toxin-antitoxin locus: repression by the OrzO antitoxin. (Eng.) // Nucleic acids research. - 2014. - Vol. 42, no. 3 - P. 1930-1946. - DOI : 10.1093 / nar / gkt1018 . - PMID 24203704 .

Links

  • Database of toxin-antitoxin systems (Unidentified) .
  • RASTA Rapid Automated Scan for Toxins and Antitoxins in Bacteria (Unidentified) .
Source - https://ru.wikipedia.org/w/index.php?title=System_toxin-antitoxin&oldid=99318942


More articles:

  • Silky Pretense
  • Dekhtyarenko, Alexander Sergeevich
  • Billig Hannah
  • Thomsen, Nikolai
  • Sometimes I Feel Like Screaming
  • Firebear Blossom
  • Zagorodie (Tver region)
  • Kanner, Yuri Isaakovich
  • Russian Drama Theater of Uzbekistan
  • Valverde Vega Canton

All articles

Clever Geek | 2019